OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

pCas-Scramble

Be the first to review this product
SKU
GE100003
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
  $470.00
In Stock*

Frequently Bought Together (4)

TA811179 CAS9 mouse monoclonal antibody,clone OTI5E5 100 ul
$447.00
CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
5 x 200 ul
$170.00
TP790148 Purified recombinant protein of S. pyogenes Cas9 endonuclease (Cas9) containing Simian virus 40 (SV40) T antigen nuclear localization sequence (NLS) on the N- and C- termini of the protein., with N-terminal HIS tag, expressed in E.coli, sterile-filtered, suitable for cell culture
500 pmol
$150.00
TP790151 Purified recombinant protein of mutant(D10A) of S. pyogenes Cas9 endonuclease (Cas9) containing Simian virus 40 (SV40) T antigen nuclear localization sequence (NLS) on the N- and C- termini of the protein., with N-terminal HIS tag, expressed in E. coli
500 pmol
$160.00
Specifications
Specifications
Product Data
Function All-in-One CRISPR/Cas9 vectors
Features
  • Negative control vector for pCas-Guide system
  • All-in-one vector
    1. Expresses human codon-optimized Cas9
    2. Expresses a scrambled guide RNA (gRNA)
Download Vector Sequence
Storage Please store at -20°C for long term storage.
Stability The dried and the suspended DNA are stable for one year from date of shipping when stored at -20°C.
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

Caspase-1 regulates TBK1 and PPARα to suppress steatosis-associated hepatocarcinogenesis
González-Navajas, Huang, Tzoumpa et al
researchsquare.com (2026)
AI Summary: OriGene's Casp1 Mouse Gene Knockout Kit (KN502562) and negative control (GE100003) were used to generate Caspase-1 knockout cells via CRISPR, enabling the study of Caspase-1's role in liver cancer development.
Snippet: … For CRISPR-mediated Casp1 426 knockout, cells were transfected with a Casp1 Mouse Gene Knockout Kit (Origene, KN502562) or 427 negative control (Origene, GE100003) according to the manufacturer’s instructions. …
Glycogen synthase kinase-3 activation and dysregulation of amyloid transport receptors expression and shedding in HIV-induced Alzheimer's disease-like pathology: modulatory effects of CCR5 antagonists
Bhargavan, Annadurai, Kanmogne
Acta Neuropathol Commun (2025) 14 (1), 16 DOI: 10.1186/s40478-025-02197-4
Cited by 1
AI Summary: OriGene’s scramble vector (GE100003) was used as a negative control in cell transfection experiments to assess the specific effects of CCR5 knockdown and overexpression on amyloid transport receptors and related Alzheimer’s disease-like pathology in the context of HIV infection.
Snippet: Negative controls included non-transfected cells and cells transfected with a scramble vector (GE100003, Origene). For CCR5 overexpression, generated stable CCR5
FigureFigureFigure
The ER thioredoxin-related transmembrane protein TMX2 controls redox-mediated tethering of ER-mitochondria contacts
Chen, Yap, Bassot et al
Cell Rep (2025) 44 (11), 116486 DOI: 10.1016/j.celrep.2025.116486
Cited by 8
AI Summary: In this study, OriGene’s pCas-Scramble (GE100003) was used as a control in gene editing experiments to investigate the role of TMX2 in regulating ER-mitochondria contacts.
Snippet: Paraformaldehyde (PFA) Electron Microscopy Sciences 15710 pCas-Scramble OriGene GE100003 Peptide-N-glycosidase F (PNGase F) NE BioLabs P0704L
Cathepsin B deficiency disrupts cortical development via PEG3, leading to depression-like behavior
Xie, Yang, Lan et al
Commun Biol (2025) 8 (1), 1097 DOI: 10.1038/s42003-025-08508-8
Cited by 4
AI Summary: OriGene’s scramble control gRNA (SKU GE100003, Cat# KN303984) was used as a negative control in gene knockout experiments to validate the effects of Cathepsin B deficiency on neuronal development in this study.
Snippet: During the generation, we also included scramble control gRNA (SKU GE100003, ORIGENE, Cat#KN303984) to serve as a negative control. …CTSB expression was assessed by Q-PCR and immunoblotting. During the generation, we also included scramble control gRNA (SKU GE100003, ORIGENE, Cat#KN303984) to serve as a negative control. …
FigureFigureFigure
CDX2 loss in colorectal cancer cells is associated with invasive properties and tumor budding
Bodmer, Uth, Mehmeti et al
Sci Rep (2025) 15 (1), 24113 DOI: 10.1038/s41598-025-07278-x
Cited by 4
AI Summary: OriGene’s pCas-Scramble CRISPR Vector (Cat#: GE100003) was used as a control in CRISPR experiments to study the effects of CDX2 loss on colorectal cancer cell migration and invasiveness.
Snippet: pt in 7.5% CO2 at 37 °C. The following lentiviral vectors CRISPR-Cas9-CDX2-gRNA1 (HGLibA_08899), CRISPR-Cas9-CDX2-gRNA2 (HGLibA_08898) (Zhang lab), and pCas-Scramble CRISPR Vector (Cat#: GE100003, Origene) contained a puromycin antibiotic-resistance gene for selection of transduced mammalian cells. The Flag-CDX2 expression vector contained a hygromycin antibiotic-resistance gene for selection o
FigureFigureFigure
Regulation of NTRK2 alternative splicing by PRPF40B controls neural differentiation and synaptic plasticity
Duarte-Ruiz, Moreno-Castillo, Yousfi et al
bioRxiv (2025)
AI Summary: OriGene’s Human Gene Knockout Kit (KN209144) and scrambled control gRNA (GE100003) were used to generate PRPF40B knockout and control cell lines, enabling the study of PRPF40B’s role in regulating NTRK2 alternative splicing and neural differentiation.
Snippet: CCCGCGCGGGGG) and gRNA for the G2 cell line (GGCCCGGGCCGTGGCCGATG). The Origene Human Gene Knockout Kit (KN209144) was used according to the manufacturer’s instructions. After selection with puromycin (1.5 µg/mL), individual cell colonies were generated using the limiting dilution method. We also included scrambled control gRNA (Origene, GE100003) to serve as a negative control
Showing 1-6 of 16 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products