OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

TAGLN2 (NM_003564) Human Over-expression Lysate

Be the first to review this product
SKU
LY418584
Transient overexpression lysate of transgelin 2 (TAGLN2) (as WB positive control)
  $436.00
In Stock*
Bulk/Customize

Frequently Bought Together (3)

TA811000S beta Actin Mouse Monoclonal Antibody, Clone OTI1, Loading Control 30 ul
$200.00
TA812766 TAGLN2 mouse monoclonal antibody,clone OTI7A5 100 ul
$447.00
TA592569 DDK Rabbit monoclonal antibody, recognizing both N- and C-terminal tags
100 ul
$519.00

Other products for "TAGLN2 or NM_003564"

Specifications
Specifications
Product Data
Species Human
Expression Host HEK293T
Expression cDNA Clone or AA Sequence TrueORF Clone RC203473
Tag C-Myc/DDK
Detection Antibodies Clone OTI4C5, Anti-DDK (FLAG) monoclonal antibody (TA50011-100)
ACCN NM_003564, NP_003555
Synonyms HA1756
Predicted MW 22.4 kDa
Components 1 vial of 100 µg total protein derived from gene specific transient over-expression cell lysate in RIPA buffer
1 vial of 100 µg whole HEK293T cell lysate in RIPA buffer
Storage The lysate is shipped with dry ice. Upon receiving, store the sample at -80°C. Also after dilution, the protein sample should be aliquoted and stored at -80°C for long term storage. Avoid repeated freeze-thaw cycles. Lysate samples can be diluted with 1x SDS-PAGE running buffer (with reducing agent). Lysate samples are stable for 12 months from the date of receipt when stored at -80°C. Lysate samples are stable for 12 months from the date of receipt when stored at -80°C.
Shipping Dry Ice
Preparation HEK293T cells in 10-cm dishes were transiently transfected with MegaTran Transfection Reagent (TT200002) and 5ug TrueORF cDNA plasmid. Transfected cells were cultured for 48hrs before collection. The cells were lysed in modified RIPA buffer (25mM Tris-HCl pH7.6, 150mM NaCl, 1% NP-40, 1mM EDTA, 1xProteinase inhibitor cocktail mix (Sigma), 1mM PMSF and 1mM Na3VO4), and then centrifuged to clarify the lysate. Protein concentration was measured by BCA kit (Thermo Scientific Inc.).
Reference Data
RefSeq NP_003555
Locus ID 8407
Cytogenetics 1q23.2
Protein Families WB
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other "TAGLN2" proteins (3)
SKU Description Size Price
PH303473 TAGLN2 MS Standard C13 and N15-labeled recombinant protein (NP_003555) 10 ug
$3,360.00
LC418584 Lyophilized TAGLN2 HEK293T cell transient overexpression lysate (as WB positive control) 20 ug
$206.00
TP303473 Recombinant protein of human transgelin 2 (TAGLN2), 20 µg 20 ug
$737.00

file-alt Citations

Oncogenic transgelin-2 is differentially regulated in isocitrate dehydrogenase wild-type vs. mutant gliomas
Beyer, Bell, McElroy et al
Oncotarget (2018) 9 (98), 37097-37111 DOI: 10.18632/oncotarget.26365
Snippet: Fisher Scientific, Waltham, MA) per the manufacturer’s protocol and TAGLN2 knock-down efficiency was measured 48 hours after transfection. For GBM30 cells, shRNA targeting TAGLN2 was purchased from Origene with the following sequences: shRNA#1: CTGTGTGCAGCGGACGCTGATGAATCTGG and shRNA#2: GGCGTCTCAGGCAGGCATGACTGGCT ACG. Control cells were transfected with scrambled shRNA control in the pGFP-V-RS s
FigureFigureFigure
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products