TAGLN2 (NM_003564) Human Tagged ORF Clone
$450.00
2 Weeks*
Specifications
| Product Data | |
| Type | Human Tagged ORF Clone |
|---|---|
| Target Symbol | TAGLN2 |
| Synonyms | HA1756 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data | |
| Chromatograms |
Chromatograms
 Sequencher program is needed, download here |
| Restriction Sites |
SgfI-MluI Cloning Scheme for this gene
|
Plasmid Map
|
| ACCN | NM_003564 |
| ORF Size | 597 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
| Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution Method | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Shipping | Ambient |
| Reference Data | |
| RefSeq | NM_003564.3 |
| RefSeq Size | 1419 bp |
| RefSeq ORF | 600 bp |
| Locus ID | 8407 |
| UniProt ID | P37802, A0A384MTL2 |
| Cytogenetics | 1q23.2 |
| Domains | calponin, CH |
| MW | 22.4 kDa |
| Summary | The protein encoded by this gene is similar to the protein transgelin, which is one of the earliest markers of differentiated smooth muscle. The specific function of this protein has not yet been determined, although it is thought to be a tumor suppressor. Multiple transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Mar 2013 |
Reviews
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
"NM_003564" in other vectors (6)
| SKU | Description | Size | Price | |
|---|---|---|---|---|
| RC203473L1 | Lenti ORF clone of Human transgelin 2 (TAGLN2), Myc-DDK-tagged | 10 ug |
$750.00
|
|
| RC203473L2 | Lenti ORF clone of Human transgelin 2 (TAGLN2), mGFP tagged | 10 ug |
$750.00
|
|
| RC203473L3 | Lenti ORF clone of Human transgelin 2 (TAGLN2), Myc-DDK-tagged | 10 ug |
$750.00
|
|
| RC203473L4 | Lenti ORF clone of Human transgelin 2 (TAGLN2), mGFP tagged | 10 ug |
$750.00
|
|
| RG203473 | TAGLN2 (tGFP-tagged) - Human transgelin 2 (TAGLN2) | 10 ug |
$650.00
|
|
| SC117900 | TAGLN2 (untagged)-Human transgelin 2 (TAGLN2) | 10 ug |
$300.00
|
|
Citations
Oncogenic transgelin-2 is differentially regulated in isocitrate dehydrogenase wild-type vs. mutant gliomas
Beyer, Bell, McElroy et al
Oncotarget (2018) 9 (98), 37097-37111 DOI: 10.18632/oncotarget.26365
Beyer, Bell, McElroy et al
Oncotarget (2018) 9 (98), 37097-37111 DOI: 10.18632/oncotarget.26365
Snippet: Fisher Scientific, Waltham, MA) per the manufacturer’s protocol and TAGLN2 knock-down efficiency was measured 48 hours after transfection. For GBM30 cells, shRNA targeting TAGLN2 was purchased from Origene with the following sequences: shRNA#1: CTGTGTGCAGCGGACGCTGATGAATCTGG and shRNA#2: GGCGTCTCAGGCAGGCATGACTGGCT ACG. Control cells were transfected with scrambled shRNA control in the pGFP-V-RS s
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Related Products
- Price:
- Actual Price:
Welcome to OriGene AI!
I'm your AI-powered guide to everything OriGene.
Ask me anything:
- Product specs
- Ordering help
- Technical questions
- How to find exactly what your experiment needs
Prefer a live agent? Connect with us by clicking the green chat icon, as seen in the image below or email our team at custsupport@origene.com.
