OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

AKIRIN2 (NM_018064) Human Over-expression Lysate

Be the first to review this product
SKU
LY413339
Transient overexpression lysate of akirin 2 (AKIRIN2) (as WB positive control)
  $436.00
5 Days*
Bulk/Customize

Frequently Bought Together (3)

TA306646 Rabbit Polyclonal Akirin2 Antibody
100 ug
$640.00
TA811000S beta Actin Mouse Monoclonal Antibody, Clone OTI1, Loading Control 30 ul
$200.00
TA592569 DDK Rabbit monoclonal antibody, recognizing both N- and C-terminal tags
100 ul
$519.00

Other products for "AKIRIN2 or NM_018064"

Specifications
Specifications
Product Data
Species Human
Expression Host HEK293T
Expression cDNA Clone or AA Sequence TrueORF Clone RC200881
Tag C-Myc/DDK
Detection Antibodies Clone OTI4C5, Anti-DDK (FLAG) monoclonal antibody (TA50011-100)
ACCN NM_018064, NP_060534
Synonyms C6orf166; dJ486L4.2; FBI1
Predicted MW 22.5 kDa
Components 1 vial of 100 µg total protein derived from gene specific transient over-expression cell lysate in RIPA buffer
1 vial of 100 µg whole HEK293T cell lysate in RIPA buffer
Storage The lysate is shipped with dry ice. Upon receiving, store the sample at -80°C. Also after dilution, the protein sample should be aliquoted and stored at -80°C for long term storage. Avoid repeated freeze-thaw cycles. Lysate samples can be diluted with 1x SDS-PAGE running buffer (with reducing agent). Lysate samples are stable for 12 months from the date of receipt when stored at -80°C. Lysate samples are stable for 12 months from the date of receipt when stored at -80°C.
Shipping Dry Ice
Preparation HEK293T cells in 10-cm dishes were transiently transfected with MegaTran Transfection Reagent (TT200002) and 5ug TrueORF cDNA plasmid. Transfected cells were cultured for 48hrs before collection. The cells were lysed in modified RIPA buffer (25mM Tris-HCl pH7.6, 150mM NaCl, 1% NP-40, 1mM EDTA, 1xProteinase inhibitor cocktail mix (Sigma), 1mM PMSF and 1mM Na3VO4), and then centrifuged to clarify the lysate. Protein concentration was measured by BCA kit (Thermo Scientific Inc.).
Reference Data
RefSeq NP_060534
Locus ID 55122
Cytogenetics 6q15
Protein Families WB
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other "AKIRIN2" proteins (3)
SKU Description Size Price
PH300881 AKIRIN2 MS Standard C13 and N15-labeled recombinant protein (NP_060534) 10 ug
$3,360.00
LC413339 Lyophilized AKIRIN2 HEK293T cell transient overexpression lysate (as WB positive control) 20 ug
$206.00
TP300881 Recombinant protein of human akirin 2 (AKIRIN2), 20 µg 20 ug
$867.00

file-alt Citations

A critical role for the nuclear protein Akirin2 in the formation of mammalian muscle in vivo
Bosch, Fuller, Weiner
Genesis (2019)
AI Summary: OriGene products contributed to this study by providing Akirin2-targeting shRNA (TF805514A/FI323227), a scrambled control shRNA (TR30015), and an Akirin2 overexpression plasmid (MR219891), which were used to manipulate Akirin2 expression and assess its role in muscle cell differentiation and development.
Snippet: Akirin2 (TF805514A/FI323227;sequence ACCACAGAACAAATTCTGTACAA CATAAA, Origene) or scrambled control (TR30015) were used (MR219891, Origene) was compared with an empty vector control plasmid (pcDNA3.1). To determine
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products