PTEN Human Gene Knockout Kit (CRISPR)

CAT#: KN402627

Reviews ()
Write a review

PTEN - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated.

KN2.0 knockout kit validation

  See Other Versions

KN402627 is the updated version of KN202627.

USD 1,290.00

2 Weeks

    • 1 kit

Product images


Product Data
Format 2 gRNA vectors, 1 linear donor
Donor DNA EF1a-GFP-P2A-Puro
Symbol PTEN
Locus ID 5728
Kit Components

KN402627G1, PTEN gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: TGCGGTCCAGAGCCAAGCGG

KN402627G2, PTEN gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TTCTACTGCCTCCAACACGG

KN402627D, Linear donor DNA containing LoxP-EF1A-tGFP-P2A-Puro-LoxP

LoxP-EF1A-tGFP-P2A-Puro-LoxP (2739 bp)

The sequence below is cassette sequence only. The linear donor DNA also contains proprietary target sequence.

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_000314, NM_001304717, NM_001304718
Synonyms 10q23del; BZS; CWS1; DEC; GLM2; MHAM; MMAC1; PTEN1; TEP1
Summary This gene was identified as a tumor suppressor that is mutated in a large number of cancers at high frequency. The protein encoded by this gene is a phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase. It contains a tensin like domain as well as a catalytic domain similar to that of the dual specificity protein tyrosine phosphatases. Unlike most of the protein tyrosine phosphatases, this protein preferentially dephosphorylates phosphoinositide substrates. It negatively regulates intracellular levels of phosphatidylinositol-3,4,5-trisphosphate in cells and functions as a tumor suppressor by negatively regulating AKT/PKB signaling pathway. The use of a non-canonical (CUG) upstream initiation site produces a longer isoform that initiates translation with a leucine, and is thought to be preferentially associated with the mitochondrial inner membrane. This longer isoform may help regulate energy metabolism in the mitochondria. A pseudogene of this gene is found on chromosome 9. Alternative splicing and the use of multiple translation start codons results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]


Other Versions

Other products for "PTEN"
Frequently bought together (2)
Rabbit monoclonal antibody against PTEN Phospho (Ser380) (clone EPR2062Y ) (Phospho-Specific)
    • 100 ul

USD 484.00

PTEN (Myc-DDK-tagged)-Human phosphatase and tensin homolog (PTEN)
    • 10 ug

USD 420.00

Customer Reviews 
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools