Neo1 Mouse Gene Knockout Kit (CRISPR)

CAT#: KN310902RB

Reviews ()
Write a review

Neo1 - mouse gene knockout kit via CRISPR, HDR mediated



HDR-mediated knockout kit validation


  See Other Versions

USD 1,290.00


Availability*
4 Weeks

Size
    • 1 kit

Product images

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA RFP-BSD
Symbol Neo1
Locus ID 18007
Kit Components

KN310902G1, Neo1 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGAGGTGCAGAGGAGTCGCC

KN310902G2, Neo1 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TGGCGGACAGCAGCGCCGGG

KN310902RB-D, donor DNA containing left and right homologous arms and RFP-BSD functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; RFP-BSD in green; Right arm in violet

GATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGTTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTCCTTCCTCTTCCAGCCCTTCCTCTTTCACTGACTGACTGACTGGAAGACACACCTTCCGGGGTTTCCCTGACGCCAGCAGCAGCAGCAGAGCCCGGCGCGCGCGCCCCGCGCCCGTGCCCGTCTCCCGAGAGCCAGAGGGGGGAGGGGAGCGGGCCCGCCGCCTGCCCCTGCGCCAGCTCGGCTCCACCGCCGCGGCTGCCCGCGAAGCGACCGCCGGGATTGGAGCCCGGCAGGCCGCGGGGCGCGAAGAGGGTGCTCGTGGGGAGGGAGGCGCGCGTGCGCGGCTGTGAGCGTGCGCGGCACGGCGCGCTCCGGCGCCCGCCCCCCACCCCGCGGTCTCCGCCCCCCTCGCTCTACCGTGAGGAGCCCGAGTCGGCGGCGGGTGGCGGCGCCTGGAACCTGGAGAGACCGAGCCACCCCCCGGCTCTCGGCCGGAATGTACTGATTCTCCTCTGCTCTCCTCCCCGCCCCGCTGCAGGAGGGAGGCGCCCGGAGTCTTTCCCCCTGGGCGCGCGAGGGGGCCGCGCGGGCCGGGCCGGGCCGGGCTGGAGCCGAGCCCTGCGGCGCAGAGACCGGCTGAGGCGCGCTGAGGGAAGGGCGCGAGCGCTCCGCGGCGCTATCGCCGCCGCCGCCGCCGCCACTCGTGGGGTAGAGTTGCTGCCGCTGCTGCTGCTGCTCGGACGCCCGGCGTCCGGCGCCGCGGCCACGAAGAGCGGCTCCCCGCCGCAGTCCGCAGGTAAGTCGGGCCGGGCCCGGGACGCCGTGGGGGCTGGGGCGCGGCACCGGCTCCCGTGGCCGCTGCGGTGGGTTTTTGTTGTTGTTTAGGATCCAGAGGGGAACGTGCGGGAACTTTTCCTCCTCGGCTCCCGTTGCTGGAGAGAAAAGGGTCTCGCGTGGTGGAAAGCGGAGCAGGCAGGAGGGGTTCCTACCGGGGGAGGGGCGCCTCCGGGATCCGGGCCGGAGCTCTGGGGTCCAGTTCTGCGCTTTGTACCGGGAGGCAGGTTCACCCCTCGCCTCTTTCCCCTCCCCCAGGCTCATCCCACTTGTAAGAGTGGGACATTCTTGTGCTCACACAAGCACCAGTAGAGGCCACTACACACCTCATTAGATAAACAATCGTACAGCCAATTCATTAATTTTCAGGAAGGGATGGAGGAGGGGGCTTGAATTCATTCTCTTCACCCTCCATCCCCCTCGGCCATGGGTTGCCCAGCTTCTGAAGTCCAGGGAAGCGCTGTCGGATCTCGAGGGACTTCCACAGTCTTCACTGACTGACTGACTGGAAAGTCCTCTCCACTGACTGTAGCCTCCAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATACGTCAAAGCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTTGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGGCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCATCCGCTTACAGACAAGCTGTGACCGTCAACGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGCGACCCGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTT

GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001042752, NM_008684
Synonyms 2610028H22Rik; AI327052; D930014N22Rik; Igdcc2

Documents

Other Versions

Other products for "Neo1"
Frequently bought together (2)
Rabbit Polyclonal Anti-Neo1 Antibody
    • 100 ul

USD 375.00


Neo1 (Myc-DDK-tagged) - Mouse neogenin (Neo1), transcript variant 1
    • 10 ug

USD 1,140.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools