Lgals3bp Mouse Gene Knockout Kit (CRISPR)

CAT#: KN309244

Reviews ()
Write a review

Lgals3bp - mouse gene knockout kit via CRISPR, HDR mediated

HDR-mediated knockout kit validation

  See Other Versions

USD 1,290.00

2 Weeks

    • 1 kit

Product images


Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol Lgals3bp
Locus ID 19039
Kit Components

KN309244G1, Lgals3bp gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGCGTTTGGGACCTTTCGTG

KN309244G2, Lgals3bp gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GGTGAGTCCTGCCCCACGAA

KN309244-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_011150
Synonyms 90K; CyCAP; MAC-2BP; Ppicap; Tango10b


Other Versions

Other products for "Lgals3bp"
Frequently bought together (1)
Lgals3bp (Myc-DDK-tagged) - Mouse lectin, galactoside-binding, soluble, 3 binding protein (Lgals3bp)
    • 10 ug

USD 610.00

Customer Reviews 
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools