OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Lats2 Mouse Gene Knockout Kit (CRISPR)

Be the first to review this product
SKU
KN309148
Lats2 - mouse gene knockout kit via CRISPR, HDR mediated
  $1,657.00
4 Weeks*

Frequently Bought Together (3)

MR226238 Lats2 (Myc-DDK-tagged) - Mouse large tumor suppressor 2 (Lats2), transcript variant B
10 ug
$289.00 $300.00
GE100003 pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
10 ug
$470.00
TT300007S A non-viral, non-electroporation, non-liposomal transfection kit using engineered mammalian proteins, tailored for high-efficiency delivery into a wide range of primary cells and difficult to transfect cell lines such as immune cells, stem cells, and neuronal cells.
20 ul
$265.00

Other products for "Lats2 or BC053028"

Specifications
Specifications
Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Vector GFP-puro
Target Symbol Lats2
Locus ID 50523
Components

KN309148G1, Lats2 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GATTGCAAGAGATTCGAGAG

KN309148G2, Lats2 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CATCCAAGGCTTCCACCCAG

KN309148D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_015771, NM_153382
UniProt ID Q7TSJ6
Synonyms 4932411G09Rik; AV277261; AW228608
Summary Negative regulator of YAP1 in the Hippo signaling pathway that plays a pivotal role in organ size control and tumor suppression by restricting proliferation and promoting apoptosis. The core of this pathway is composed of a kinase cascade wherein STK3/MST2 and STK4/MST1, in complex with its regulatory protein SAV1, phosphorylates and activates LATS1/2 in complex with its regulatory protein MOB1, which in turn phosphorylates and inactivates YAP1 oncoprotein and WWTR1/TAZ. Phosphorylation of YAP1 by LATS2 inhibits its translocation into the nucleus to regulate cellular genes important for cell proliferation, cell death, and cell migration. Acts as a tumor suppressor which plays a critical role in centrosome duplication, maintenance of mitotic fidelity and genomic stability. Negatively regulates G1/S transition by down-regulating cyclin E/CDK2 kinase activity. Negative regulator of the androgen receptor. Phosphorylates SNAI1 in the nucleus leading to its nuclear retention and stabilization, which enhances its epithelial-mesenchymal transition and tumor cell invasion/migration activities. This tumor-promoting activity is independent of its effects upon YAP1 or WWTR1/TAZ (By similarity).UniProtKB/Swiss-Prot Function
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
GA205323 Lats2 CRISPRa kit - CRISPR gene activation of mouse large tumor suppressor 2 1 kit
$1,657.00
KN309148BN Lats2 - mouse gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN309148LP Lats2 - mouse gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN309148RB Lats2 - mouse gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN509148 Lats2 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products