Irf5 Mouse Gene Knockout Kit (CRISPR)

CAT#: KN308427

Reviews ()
Write a review

Irf5 - mouse gene knockout kit via CRISPR, HDR mediated

HDR-mediated knockout kit validation

USD 1,290.00

4 Weeks

    • 1 kit

Product images


Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol Irf5
Locus ID 27056
Kit Components

KN308427G1, Irf5 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GAATGAGAGAGTGTCTTCCC

KN308427G2, Irf5 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: AAAACTCAGCAGACTTACTT

KN308427-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001252382, NM_001311083, NM_012057
Synonyms AW491843; mirf5


Other products for "Irf5"
Frequently bought together (2)
Rabbit Polyclonal Anti-IRF5 Antibody
    • 100 ul

USD 375.00

Irf5 (myc-DDK-tagged) - Mouse interferon regulatory factor 5 (Irf5), transcript variant 1
    • 10 ug

USD 530.00

Customer Reviews 
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones