Ido1 Mouse Gene Knockout Kit (CRISPR)

CAT#: KN308091RB

Reviews ()
Write a review

Ido1 - mouse gene knockout kit via CRISPR, HDR mediated



HDR-mediated knockout kit validation


  See Other Versions

USD 1,290.00


Availability*
2 Weeks

Size
    • 1 kit

Product images

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA RFP-BSD
Symbol Ido1
Locus ID 15930
Kit Components

KN308091G1, Ido1 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CATCTATGTGGTGGTCTTCA

KN308091G2, Ido1 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CTTTGCTCTACCACATCCAC

KN308091RB-D, donor DNA containing left and right homologous arms and RFP-BSD functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; RFP-BSD in green; Right arm in violet

AAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGGGTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGTTGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATAAAATTGTAAACGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGCCCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCAAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTACTATGGTTGCTTTGACGTATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGGAGGCTACAGTCAGTGGAGAGGACTTTCACAGGCTGTCGCCGTGCTCATTTGATAACTGCCCGTTATTCATGCGACACTGTCCCAGGTTGTGTTTCAGAGCTGGAGAGACAAAACACTGACATTTAAAACAGGACATAAGTTCCCTCGTGTGAAAGCCAATAACGGACAGCTATTGCTAGTTCGGCTGTCTTTATTTTAAACCCAAACTCTGAACGTTTTCTAAAGCAAAATGCATTCTCCTGGTCACCTGTCCTCATGGTTCTTGTCATGTGAGTTGGGCACTTTGTGGCTTGAACACCCAATCCTCCTGCTGGGGTAACAGGTGGCCACCCAAACCACTGATGGGGTGGTTTCCAGGGCCGAGGCCTGAGTGTGCACTCGGTCACCATAATTGGCACTGGGAAGCTGAGGCCATCAGAGCCAACAGTTGATGTCCTTATGGGATAAATCTGATAAGAAACACAAATGTTTAGTTTCTTCATATGACGAAGAGAGATCCTTTGTGGTTTGGTTGTTTATCAAATTGCAAATACATAAAACAGAAAATGAAACTGTCCCAGGTGGAAGCCACTTCTCCCCGAGTATTACGTGTCAGCTGTGGGGTTTGGCTAAACCCTATAAGAGATGCTGGGACATTCCTTCAGTGGCCAAGTGGGGGGTCAGTGGAGTAGACAGCAACAGATGAATTTCTAAGTAAGCAGCTCTGTCTCAGGTTCTCTTAAGCGAATGAGTGATGTCAAATTCAGAGCCCACTTACAAAAAGGGAGCCTGGCTGCTCTTCAGTGTTTCTTCTTCTTCTTCTTCCTCAAAATCCAGCCCTTACTTTCTTAACCTGGAAATGTGAAGTGGTGAGGGAAGGGGCACATGAGAAGTCTTTTTAGTTTCGTGAAGGAAACGGGCTCATAGAAGGGAAGCCAGTTTGTCACAATGACTTTTCCAGCACGGTGTCCTGAAACAGCAACATTCAAATGCCCAGAGCCATAGAAACATTTCTCTTCTGAACCTTATCAAATGGATCGATCTGTGCTCCTCACTGATTTCAGTATATGAGATGATAGATCAAGCAACTTTTGTTTCATACTAATAATGCTTGTGGTTTGCCAAGCATAATCCAAAGGAAGGTATGAACAACCTTGATTGTGCTTTTGTGCAAGTTTTGGAATCCAAGTGCGGTGCATGTGGGGGAAATGCCTCGTGTCTCAACCAGGTACAGTGGGAAACAACTATAGTTCCATCACCCAGGAGTCAGAGGCAGGGGCATAGCCTCAAATTCAAGGTCACTCTCGCCGGTTGGACTTTAGATCAGAAGGGATCTTGCTGCCGCCCGAAAGAGGAAGGGCTGGAAGAGGAAGGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGAACCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATC

GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001293690, NM_008324
Synonyms Ido; Indo

Documents

Other Versions

Other products for "Ido1"
Frequently bought together (2)
Mouse monoclonal anti-IDO1 antibody
    • 100 ug

USD 530.00


Ido1 (myc-DDK-tagged) - Mouse indoleamine 2,3-dioxygenase 1 (Ido1), transcript variant 2
    • 10 ug

USD 330.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools