Frs2 Mouse Gene Knockout Kit (CRISPR)

CAT#: KN306139

Frs2 - mouse gene knockout kit via CRISPR, HDR mediated

Product Images

Specifications

Product Data

• Format: 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
• Donor DNA: GFP-puro
• Symbol: Frs2
• Locus ID: 327826
• Components:

  KN306139G1, Frs2 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: ACACTGTCCCAGATAACCAT

  KN306139G2, Frs2 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TGACCTTAAACTTGTTCCGA

  KN306139D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

  GE100003, scramble sequence in pCas-Guide vector

• Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Reference Data

• RefSeq: NM_177798
• UniProt ID: Q8C180
• Synonyms: 4732458E18; C330018A15Rik; Frs2alpha; SNT1
• Summary: Adapter protein that links activated FGR and NGF receptors to downstream signaling pathways. Plays an important role in the activation of MAP kinases and in the phosphorylation of PIK3R1, the regulatory subunit of phosphatidylinositol 3-kinase, in response to ligand-mediated activation of FGFR1. Modulates signaling via SHC1 by competing for a common binding site on NTRK1.[UniProtKB/Swiss-Prot Function]