Dpp4 Mouse Gene Knockout Kit (CRISPR)

CAT#: KN304781LP

Reviews ()
Write a review

Dpp4 - mouse gene knockout kit via CRISPR, HDR mediated



HDR-mediated knockout kit validation


  See Other Versions

USD 1,290.00


Availability*
4 Weeks

Size
    • 1 kit

Product images

Specifications

Product Data
Format 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control
Donor DNA Luciferase-Puro
Symbol Dpp4
Locus ID 13482
Kit Components

KN304781G1, Dpp4 gRNA vector 1 in pCas-Guide CRISPR vector

KN304781G2, Dpp4 gRNA vector 2 in pCas-Guide CRISPR vector

KN304781LP-D, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; Luciferase-Puro in green; Right arm in violet

TTACTTTTTTGCGGGGGGAGGGACTCCGGCAAAGCAAGTGAACATTCCCCAGGGAGGATTAATACAGATATCCAACCTGAAGTGTCATTCAAAAGGGAACAATCACCTTTTCTCTTTCTTTGCCAGCCAGATAACATGGGACACCCAACCCCTTCTCTCAGACTGACAGACCTCTCAGGGAAGGGGACAAGAGAACTGGCAGCTAGTTTCTGCAGTGAGCCGTGAATCTGCCAAACTCCATGCCTGCTTGAACCTCAGCTGCCTCGATTATCCACGCAAGGGAGCAACAGTTAAACCTCAATGTGCAATGTCTCTTTTAGCAAAGGGGGTTCGCTGTTCCCCTTATCCCTCACTCATGGGGGCCCTGCGTGCTACTTCCTGGCTCGCCTAGTGGTCCTACCGCGCTGGGTCGGCTGCCCCGCGCTCACACTGTGCACCGAAGCCCGCCTTGCGCTAACTAATGTTTAACTCAGGCCGAAACTTGGCGGCGAGCTCAGGGTGACTGCGTGCAGAGCAGCCGCGCAGGACGTCCGTCTCTGCGCGCAGTGACTTCTGCCTGCGCTCAAGCTTCAGAGTTCAGTTTCAAGGAGCCGCCCGACCGCGGAAGCCACGGGGCCACCCTCACAGGTGAAGGCACGTCCGTCCCGGGAACTGGCTTAGATCTCTGGCGTGTCCTACTGGGACCCAGGCACTGAGCCTTGGAAGTCGGGGACGGTCACCCGTGGAACGCACGCGGCACTCTCATTTGGCATCAGACGGGTGGGTGGGAGGAGAGAAGCCAACAAGATCATAAGATCATGCTCAGGGCCAAAATTCAAGGGCTTCTGCCTGAGTGAACGCCAAACCCCTCAGGTCTACTAGTGCACCTGCAAACTCCTCTGCCTCTGAAGGGGCCTAAGTCCCAACCCTCTTCGCAGAGAGGAACAAAGACTTCCCCTCTAATTGTTTGCAATCTGACCTGCTTGCAGACACCGTGGAAGGTTCTTCTGGGACTGCTTGGTGTCGCTGCGCTTGTCACCATCATCACCGTGCCAATAGTTCTGCTGAGCAAAGGTAGAACCTTGCAACATCTTAAAAAGAGAGGGTGGTTGGAGACGGGGTCAGGCGGCTCTCAAAGCGAGCTCAGTTTATTGGGGGGCCTTGACCCCTGTGCTGGGTTATGGCTGAAGAGACTGGTAAGTGTCTCTAAATGTATTTGCT

GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001159543, NM_010074
Synonyms Cd26; Dpp-4; THAM
Summary Cell surface glycoprotein receptor involved in the costimulatory signal essential for T-cell receptor (TCR)-mediated T-cell activation. Acts as a positive regulator of T-cell coactivation, by binding at least ADA, CAV1, IGF2R, and PTPRC. Its binding to CAV1 and CARD11 induces T-cell proliferation and NF-kappa-B activation in a T-cell receptor/CD3-dependent manner. Its interaction with ADA also regulates lymphocyte-epithelial cell adhesion. In association with FAP is involved in the pericellular proteolysis of the extracellular matrix (ECM), the migration and invasion of endothelial cells into the ECM. May be involved in the promotion of lymphatic endothelial cells adhesion, migration and tube formation. When overexpressed, enhanced cell proliferation, a process inhibited by GPC3. Acts also as a serine exopeptidase with a dipeptidyl peptidase activity that regulates various physiological processes by cleaving peptides in the circulation, including many chemokines, mitogenic growth factors, neuropeptides and peptide hormones. Removes N-terminal dipeptides sequentially from polypeptides having unsubstituted N-termini provided that the penultimate residue is proline.[UniProtKB/Swiss-Prot Function]

Other Versions

Other products for "Dpp4"
Frequently bought together (1)
Dpp4 (Myc-DDK-tagged) - Mouse dipeptidylpeptidase 4 (Dpp4), transcript variant 2
    • 10 ug

USD 628.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Molbio tools