Dll3 Mouse Gene Knockout Kit (CRISPR)

CAT#: KN304621

Reviews ()
Write a review

Dll3 - mouse gene knockout kit via CRISPR, HDR mediated

HDR-mediated knockout kit validation

  See Other Versions

USD 1,290.00

2 Weeks

    • 1 kit

Product images


Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol Dll3
Locus ID 13389
Kit Components

KN304621G1, Dll3 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GCTTTCCCAGACGCTGATCC

KN304621G2, Dll3 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: AAAAGCCAGGATCAGCGTCT

KN304621-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_007866
Synonyms pu; pudgy
Summary Inhibits primary neurogenesis. May be required to divert neurons along a specific differentiation pathway. Plays a role in the formation of somite boundaries during segmentation of the paraxial mesoderm.[UniProtKB/Swiss-Prot Function]

Other Versions

Other products for "Dll3"
Frequently bought together (1)
Dll3 (Myc-DDK-tagged) - Mouse delta-like 3 (Drosophila) (Dll3)
    • 10 ug

USD 494.00

Customer Reviews 
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Molbio tools