Cdk5rap2 Mouse Gene Knockout Kit (CRISPR)

CAT#: KN303046RB

Reviews ()
Write a review

Cdk5rap2 - mouse gene knockout kit via CRISPR, HDR mediated



HDR-mediated knockout kit validation


  See Other Versions

USD 1,290.00


Availability*
4 Weeks

Size
    • 1 kit

Product images

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA RFP-BSD
Symbol Cdk5rap2
Locus ID 214444
Kit Components

KN303046G1, Cdk5rap2 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GACTCGGGGATGGAAGAGGA

KN303046G2, Cdk5rap2 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GCCCTGCCTGGGACCCTCAG

KN303046RB-D, donor DNA containing left and right homologous arms and RFP-BSD functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; RFP-BSD in green; Right arm in violet

AAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGGGTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGTTGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATAAAATTGTAAACGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGCCCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCAAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTACTATGGTTGCTTTGACGTATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGGAGGCTACAGTCAGTGGAGAGGACTTTCACAGGCTGTCGCCGTGCTCATTTGATAACTGCCCGTTATTCATGCGACACACTACCGTTTGTAATAGCGCTCCACAGGTGGTATTTTTCTAAATCGAAGCAGAACTCAATTATCTGAGTCTCAACTTAAGGCAGAGCCTTTTGGGTAGAAAGAGCCTAAGGAGCGATTTTGGAGTCATGAGTCTGGAACACCAAACAGATTGATACTCTGAGCTGTTCCACCTCCCGCTTAAATTAACTGATCCCGGCGGACTTTTACCCTCAACAAATATGGCGCTCGCCTTGGCTTCGGCCCGAATGCCCTCACCCACGAAACATGGCTACCGCTTCTTTTCTCCTAGTGTTGCACGCTGGAGTGCGCAGGTTCTGCCCTGAGTTAAGATGGCGTCCAGGCAAAGCTCTTCTTGCCCGGTTTCGGGTCGTTGCAGGGCGGCTTCACCGCGCGTGCCTGGGTGACCCCGCCTTGTTTCCGTAGGAAGAAGCGCCGGGAAAGATGGCGGCGGCTGCGGTTTGAATTCCAGCGGCGCCGCTTGACTGAGAACAAGAGCTGGGTTGGAGGGGGCGGGACCTGGGGAACCGAGCGCGCCGCGACTGCCGGGGAACCAGTGGCGCTGCCGCCGCCGACACCGGCGCCACCACTCTGCGTTCACGCCCTGGCTTTGGGATTCGTGGTACCTGGGTTGGGGTTCCCGTTGATGGCGACTCACTCCCTGGAGGCCTTCGGTTTGCTTGGGGATGGTCTCGGCTGCGCCCCGAGTGTGGTGGGACCTGGGTGTCCAGCCAGCACTACATTGGACTGTGTGTTGTGTGTTCTGGAGTACTTTGAGGACGATGTGTAGGCTAGGCAGGGGGGCTTTTTGAAAGAGTGTGAGGAGATGGGTCTAATTAGTAGGGGGTGGCTGGAACTGGACATCAGAGCACTTAGGTGGTTGATTCTTGTTTGGGGCTTTGCATTCATTATGGGGAGTGTAGTTGTTATTTTAGACTTTGTTTATGGGGTCACGGGACAAAGTTCTGTGGAGCCTTGGCTAGAGATGGACAAAATTTAATTAAAAAAACGGCCTATACCCTGACCACGTAGGTGACCTTGGTAAGTTGACTTCCCCACTGAAAAGTGTACTAACGCCGATGTGCACTCACCAAAAACGGGATGAGAATGAAAAGAAGCAATGGCTACCCAGCAGTTGTATTGGCTGACATTCAACCGTGGTGAAAAGGATGATGACTACCACTATTACAAGTTGTGGCTTCTCACTCTCGCCGGTTGGACTTTAGATCAGAAGGGATCTTGCTGCCGCCCGAAAGAGGAAGGGCTGGAAGAGGAAGGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGAACCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATC

GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001313762, NM_145990
Synonyms 2900018K03Rik; an; mKIAA1633

Documents

Other Versions

Other products for "Cdk5rap2"
Frequently bought together (1)
Cdk5rap2 (Myc-DDK-tagged) - Mouse CDK5 regulatory subunit associated protein 2 (Cdk5rap2)
    • 10 ug

USD 2,100.00

Customer Reviews 
Loading...
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
68 Mouse Clones
Molbio tools