CHD1L Human Gene Knockout Kit (CRISPR)

CAT#: KN223499

CHD1L - human gene knockout kit via CRISPR, HDR mediated

 HDR-mediated knockout kit validation

USD 1,290.00

4 Weeks

    • 1 kit

Product images


Product Data
Symbol CHD1L
Locus ID 9557
Kit Components

KN223499G1, CHD1L gRNA vector 1 in pCas-Guide vector, 3-5 ug, Target Sequence: TCATACTGAGGGCCGAGCCG

KN223499G2, CHD1L gRNA vector 2 in pCas-Guide vector, 3-5 ug, Target Sequence: CGCGCGGGCGCTACTAGCCG

KN223499-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001256336, NM_001256337, NM_001256338, NM_001348451, NM_001348452, NM_001348453, NM_001348454, NM_001348455, NM_001348456, NM_001348457, NM_001348458, NM_001348459, NM_001348460, NM_001348461, NM_001348462, NM_001348463, NM_001348464, NM_001348465, NM_001348466, NM_004284, NM_024568, NR_046070, NR_145681, NR_145682, NR_145683, NR_145684, NR_145685, NR_145686, NR_145687, NR_145688, NR_145689, NR_145690, NR_145691, NR_145692, NR_145693, NR_145694, NR_145695, XM_006711639, XM_017002858, XM_017002859, XM_017002860, XM_017002861, XM_017002862, XM_017002863, XM_017002864, XM_378182, XR_001737550
Synonyms ALC1; CHDL
Summary This gene encodes a DNA helicase protein involved in DNA repair. The protein converts ATP to add poly(ADP-ribose) as it regulates chromatin relaxation following DNA damage. Several alternatively spliced transcripts variants have been described for this gene. [provided by RefSeq, Jan 2012].


Other products for "CHD1L"
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
10 percent off protein banner ad
68 Mouse Clones
20%off selected tag antibodies