YAP1 Human Gene Knockout Kit (CRISPR)

CAT#: KN214393

Reviews ()
Write a review

YAP1 - human gene knockout kit via CRISPR, HDR mediated

HDR-mediated knockout kit validation

  See Other Versions

USD 1,290.00

2 Weeks

    • 1 kit

Product images


Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol YAP1
Locus ID 10413
Kit Components

KN214393G1, YAP1 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CAGGGCCCGCCGTCCGGACC

KN214393G2, YAP1 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GCTGCGAAGGCGGCTGCCCT

KN214393-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001130145, NM_001195044, NM_001195045, NM_001282097, NM_001282098, NM_001282099, NM_001282100, NM_001282101, NM_006106
Synonyms COB1; YAP; YAP2; YAP65; YKI
Summary This gene encodes a downstream nuclear effector of the Hippo signaling pathway which is involved in development, growth, repair, and homeostasis. This gene is known to play a role in the development and progression of multiple cancers as a transcriptional regulator of this signaling pathway and may function as a potential target for cancer treatment. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2013]


Other Versions

Other products for "YAP1"
Frequently bought together (2)
YAP1 (Myc-DDK-tagged)-Human Yes-associated protein 1 (YAP1), transcript variant 1
    • 10 ug

USD 433.00

Mouse Monoclonal YAP1 Antibody (1A12)
    • 100 ul

USD 385.00

Customer Reviews 
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Molbio tools