OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

CrkRS (CDK12) Human Gene Knockout Kit (CRISPR)

Be the first to review this product
SKU
KN213898
CDK12 - human gene knockout kit via CRISPR, HDR mediated
  $1,657.00
4 Weeks*

Frequently Bought Together (4)

TA374550 CDK12 Rabbit polyclonal Antibody
100 ul
$410.00
RC226399 CDK12 (Myc-DDK-tagged)-Human cyclin-dependent kinase 12 (CDK12), transcript variant 2
10 ug
$1,267.00
GE100003 pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
10 ug
$470.00
TT300007S A non-viral, non-electroporation, non-liposomal transfection kit using engineered mammalian proteins, tailored for high-efficiency delivery into a wide range of primary cells and difficult to transfect cell lines such as immune cells, stem cells, and neuronal cells.
20 ul
$265.00

Other products for "CrkRS or NM_015083"

Specifications
Specifications
Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Target Symbol CrkRS
Locus ID 51755
Components

KN213898G1, CrkRS gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GGTCACCAACCCCATGTCTT

KN213898G2, CrkRS gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TGTGCCCAGGGATGCTGCTT

KN213898D, donor DNA containing left and right homologous arms and functional cassette.

GE100003, scramble sequence in pCas-Guide vector
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_015083, NM_016507
UniProt ID Q9NYV4
Synonyms CRK7; CRKR; CRKRS
Summary Cyclin-dependent kinase that phosphorylates the C-terminal domain (CTD) of the large subunit of RNA polymerase II (POLR2A), thereby acting as a key regulator of transcription elongation. Regulates the expression of genes involved in DNA repair and is required for the maintenance of genomic stability. Preferentially phosphorylates 'Ser-5' in CTD repeats that are already phosphorylated at 'Ser-7', but can also phosphorylate 'Ser-2'. Required for RNA splicing, possibly by phosphorylating SRSF1/SF2. Involved in regulation of MAP kinase activity, possibly leading to affect the response to estrogen inhibitors.UniProtKB/Swiss-Prot Function
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
GA109977 CDK12 CRISPRa kit - CRISPR gene activation of human cyclin dependent kinase 12 1 kit
$1,657.00
KN413898 CDK12 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products