PIK3CA Human Gene Knockout Kit (CRISPR)

CAT#: KN213112

PIK3CA - human gene knockout kit via CRISPR

change donor?

 HDR-mediated knockout kit validation

USD 1,290.00

2 Weeks

    • 1 kit

Product images


Product Data
Symbol PIK3CA
Locus ID 5290
Kit Components

KN213112G1, PIK3CA gRNA vector 1 in pCas-Guide vector, Target Sequence: AGTTCACCTGATGATGGTCG

KN213112G2, PIK3CA gRNA vector 2 in pCas-Guide vector, Target Sequence: GGATTCTTGGGGGCATCAAG

KN213112-D, donor DNA containing Left and right homologous arms and GFP-puro functional cassette.
Homologous arm and GFP-puro sequences

pUC vector backbone in black; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_006218, XM_006713658, XM_011512894
Synonyms CLOVE; CWS5; MCAP; MCM; MCMTC; p110-alpha; PI3K; PI3K-alpha
Summary Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. A pseudogene of this gene has been defined on chromosome 22. [provided by RefSeq, Apr 2016].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
