AQP7 Human Gene Knockout Kit (CRISPR)

CAT#: KN212363

AQP7 - human gene knockout kit via CRISPR, HDR mediated

 HDR-mediated knockout kit validation

USD 1,290.00

2 Weeks

    • 1 kit

Product images


Product Data
Symbol AQP7
Locus ID 364
Kit Components

KN212363G1, AQP7 gRNA vector 1 in pCas-Guide vector, 3-5 ug, Target Sequence: GCCCAGCCTTGTTAGCTTTC

KN212363G2, AQP7 gRNA vector 2 in pCas-Guide vector, 3-5 ug, Target Sequence: ACAAGAGCCAGTCCTTGCAA

KN212363-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001170, NM_001318156, NM_001318157, NM_001318158, NR_134513, NR_134514, NR_134515, XM_005251453, XM_006716765, XM_011517866, XM_011517867, XM_017014700, XM_017014701, XM_017014702, XM_017014703, XM_017014704, XM_017014705, XM_017014706
Synonyms AQP7L; AQPap; GLYCQTL
Summary Forms a channel for water and glycerol. [UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
