OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Dystrophin (DMD) Human Gene Knockout Kit (CRISPR)

Be the first to review this product
SKU
KN211508BN
DMD - human gene knockout kit via CRISPR, HDR mediated
  $1,657.00
4 Weeks*

Frequently Bought Together (4)

TA375509 Dystrophin Rabbit polyclonal Antibody
100 ul
$410.00
RC215529 DMD (Myc-DDK-tagged)-Human dystrophin (DMD), transcript variant Dp71ab
10 ug
$579.00
GE100003 pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
10 ug
$470.00
TT300007S A non-viral, non-electroporation, non-liposomal transfection kit using engineered mammalian proteins, tailored for high-efficiency delivery into a wide range of primary cells and difficult to transfect cell lines such as immune cells, stem cells, and neuronal cells.
20 ul
$265.00

Other products for "Dystrophin or NM_000109"

Specifications
Specifications
Product Data
Format 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control
Vector mBFP-Neo
Target Symbol Dystrophin
Locus ID 1756
Components

KN211508G1, Dystrophin gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: ACAAGCAGCTGTTGGTAGCT

KN211508G2, Dystrophin gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TTCAAACATATGCTTTGTCA

KN211508BND, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette.

GE100003, scramble sequence in pCas-Guide vector
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_000109, NM_004006, NM_004007, NM_004009, NM_004010, NM_004011, NM_004012, NM_004013, NM_004014, NM_004015, NM_004016, NM_004017, NM_004018, NM_004019, NM_004020, NM_004021, NM_004022, NM_004023
UniProt ID P11532
Synonyms BMD; CMD3B; DXS142; DXS164; DXS206; DXS230; DXS239; DXS268; DXS269; DXS270; DXS272; MRX85
Summary This gene spans a genomic range of greater than 2 Mb and encodes a large protein containing an N-terminal actin-binding domain and multiple spectrin repeats. The encoded protein forms a component of the dystrophin-glycoprotein complex (DGC), which bridges the inner cytoskeleton and the extracellular matrix. Deletions, duplications, and point mutations at this gene locus may cause Duchenne muscular dystrophy (DMD), Becker muscular dystrophy (BMD), or cardiomyopathy. Alternative promoter usage and alternative splicing result in numerous distinct transcript variants and protein isoforms for this gene. provided by RefSeq, Dec 2016
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
GA101220 DMD CRISPRa kit - CRISPR gene activation of human dystrophin 1 kit
$1,657.00
KN211508 DMD - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN211508LP DMD - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN211508RB DMD - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN411508 DMD - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products