BMPR1B Human Gene Knockout Kit (CRISPR)

CAT#: KN210218

BMPR1B - human gene knockout kit via CRISPR, HDR mediated

 HDR-mediated knockout kit validation

USD 1,290.00

2 Weeks

    • 1 kit

Product images


Product Data
Symbol BMPR1B
Locus ID 658
Kit Components

KN210218G1, BMPR1B gRNA vector 1 in pCas-Guide vector, 3-5 ug, Target Sequence: TCTTCTCTCTATGCACACAA

KN210218G2, BMPR1B gRNA vector 2 in pCas-Guide vector, 3-5 ug, Target Sequence: TCGTGGCTTTTATCGCAGAA

KN210218-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

pUC vector backbone in gray; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001203, NM_001256792, NM_001256793, NM_001256794, XM_011532201, XM_017008558, XM_017008559, XM_017008560, XM_017008561
Synonyms ALK-6; ALK6; AMDD; BDA1D; BDA2; CDw293
Summary This gene encodes a member of the bone morphogenetic protein (BMP) receptor family of transmembrane serine/threonine kinases. The ligands of this receptor are BMPs, which are members of the TGF-beta superfamily. BMPs are involved in endochondral bone formation and embryogenesis. These proteins transduce their signals through the formation of heteromeric complexes of 2 different types of serine (threonine) kinase receptors: type I receptors of about 50-55 kD and type II receptors of about 70-80 kD. Type II receptors bind ligands in the absence of type I receptors, but they require their respective type I receptors for signaling, whereas type I receptors require their respective type II receptors for ligand binding. Mutations in this gene have been associated with primary pulmonary hypertension. Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2012].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
