OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

BCMA (TNFRSF17) Human Gene Knockout Kit (CRISPR)

Be the first to review this product
SKU
KN208851BN
BCMA/TNFRSF17 - human gene knockout kit via CRISPR, HDR mediated
  $1,657.00
4 Weeks*

Frequently Bought Together (4)

TA814060 TNFRSF17 mouse monoclonal antibody, clone OTI3H5 100 ul
$447.00
RC208851 BCMA/TNFRSF17 (Myc-DDK-tagged)-Human tumor necrosis factor receptor superfamily, member 17 (BCMA/TNFRSF17)
10 ug
$289.00 $450.00
GE100003 pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
10 ug
$470.00
TT300007S A non-viral, non-electroporation, non-liposomal transfection kit using engineered mammalian proteins, tailored for high-efficiency delivery into a wide range of primary cells and difficult to transfect cell lines such as immune cells, stem cells, and neuronal cells.
20 ul
$265.00

Other products for "BCMA or NM_001192"

Specifications
Specifications
Product Data
Format 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control
Vector mBFP-Neo
Target Symbol BCMA
Locus ID 608
Components

KN208851G1, BCMA gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GAAGAACATCGAAGTTGACA

KN208851G2, BCMA gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: TAACGCTGACATGTTAGAGG

KN208851BND, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette.

GE100003, scramble sequence in pCas-Guide vector
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001192
UniProt ID Q02223
Synonyms BCM; BCMA; CD269; TNFRSF13A
Summary The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is preferentially expressed in mature B lymphocytes, and may be important for B cell development and autoimmune response. This receptor has been shown to specifically bind to the tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13B/TALL-1/BAFF), and to lead to NF-kappaB and MAPK8/JNK activation. This receptor also binds to various TRAF family members, and thus may transduce signals for cell survival and proliferation. provided by RefSeq, Jul 2008
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
GA100418 TNFRSF17 CRISPRa kit - CRISPR gene activation of human TNF receptor superfamily member 17 1 kit
$1,657.00
KN208851 BCMA/TNFRSF17 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN208851LP BCMA/TNFRSF17 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN208851RB BCMA/TNFRSF17 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN408851 BCMA/TNFRSF17 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products