OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

CYBB Human Gene Knockout Kit (CRISPR)

Be the first to review this product
SKU
KN207544BN
CYBB - human gene knockout kit via CRISPR, HDR mediated
  $1,657.00
4 Weeks*

Frequently Bought Together (4)

TA351456 Rabbit Polyclonal Anti-CYBB Antibody
100 ul
$205.00
RC207544 CYBB (Myc-DDK-tagged)-Human cytochrome b-245, beta polypeptide (CYBB)
10 ug
$289.00 $531.00
GE100003 pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
10 ug
$470.00
TT300007S A non-viral, non-electroporation, non-liposomal transfection kit using engineered mammalian proteins, tailored for high-efficiency delivery into a wide range of primary cells and difficult to transfect cell lines such as immune cells, stem cells, and neuronal cells.
20 ul
$265.00

Other products for "CYBB or NM_000397"

Specifications
Specifications
Product Data
Format 2 gRNA vectors, 1 mBFP-Neo donor, 1 scramble control
Vector mBFP-Neo
Target Symbol CYBB
Locus ID 1536
Components

KN207544G1, CYBB gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CTGACTTCTCGGGGTTATCT

KN207544G2, CYBB gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GGGAACTGGGCTGTGAATGA

KN207544BND, donor DNA containing left and right homologous arms and mBFP-Neo functional cassette.

GE100003, scramble sequence in pCas-Guide vector
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_000397
UniProt ID P04839
Synonyms AMCBX2; CGD; GP91-1; GP91-PHOX; GP91PHOX; IMD34; NOX2; p91-PHOX
Summary Cytochrome b (-245) is composed of cytochrome b alpha (CYBA) and beta (CYBB) chain. It has been proposed as a primary component of the microbicidal oxidase system of phagocytes. CYBB deficiency is one of five described biochemical defects associated with chronic granulomatous disease (CGD). In this disorder, there is decreased activity of phagocyte NADPH oxidase; neutrophils are able to phagocytize bacteria but cannot kill them in the phagocytic vacuoles. The cause of the killing defect is an inability to increase the cell's respiration and consequent failure to deliver activated oxygen into the phagocytic vacuole. provided by RefSeq, Jul 2008
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
GA101085 CYBB CRISPRa kit - CRISPR gene activation of human cytochrome b-245 beta chain 1 kit
$1,657.00
KN207544 CYBB - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN207544LP CYBB - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN207544RB CYBB - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN407544 CYBB - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products