ULK2 Human Gene Knockout Kit (CRISPR)

CAT#: KN206010

ULK2 - human gene knockout kit via CRISPR

change donor?

 HDR-mediated knockout kit validation

USD 1,290.00

4 Weeks

    • 1 kit

Product images


Product Data
Symbol ULK2
Locus ID 9706
Kit Components

KN206010G1, ULK2 gRNA vector 1 in pCas-Guide vector, Target Sequence: CCCCCGGAAGACCACGGCGA

KN206010G2, ULK2 gRNA vector 2 in pCas-Guide vector, Target Sequence: TACAGCAAGAGGGATCTCGT

KN206010-D, donor DNA containing Left and right homologous arms and GFP-puro functional cassette.
Homologous arm and GFP-puro sequences

pUC vector backbone in black; Left arm sequence in blue; GFP-puro in green; Right arm in violet


GE100003, scramble sequence in pCas-Guide vector

Disclaimer The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001142610, NM_014683, XM_011524087, XM_017025424, XM_017025425, XM_017025426, XM_017025427, XM_017025428, XR_001752700, XR_001752701
Synonyms ATG1B; Unc51.2
Summary This gene encodes a protein that is similar to a serine/threonine kinase in C. elegans which is involved in axonal elongation. The structure of this protein is similar to the C. elegans protein in that both proteins have an N-terminal kinase domain, a central proline/serine rich (PS) domain, and a C-terminal (C) domain. The gene is located within the Smith-Magenis syndrome region on chromosome 17. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Dec 2008].
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
