OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

SEPTIN7 Human Gene Knockout Kit (CRISPR)

Be the first to review this product
SKU
KN205163
SEPT7 - human gene knockout kit via CRISPR, HDR mediated
  $1,657.00
4 Weeks*

Frequently Bought Together (4)

TA349782 Rabbit Polyclonal Anti-SEPT7 Antibody
100 ul
$205.00
RC205163 SEPT7 (Myc-DDK-tagged)-Human septin 7 (SEPT7), transcript variant 1
10 ug
$457.00
GE100003 pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
10 ug
$470.00
TT300007S A non-viral, non-electroporation, non-liposomal transfection kit using engineered mammalian proteins, tailored for high-efficiency delivery into a wide range of primary cells and difficult to transfect cell lines such as immune cells, stem cells, and neuronal cells.
20 ul
$265.00

Other products for "SEPTIN7 or NM_001011553"

Specifications
Specifications
Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Vector GFP-puro
Target Symbol SEPTIN7
Locus ID 989
Components

KN205163G1, SEPTIN7 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: CCGAAGCTGAGACTCACCCA

KN205163G2, SEPTIN7 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GAGCCGCTGACCCCAAGTCG

KN205163D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001011553, NM_001242956, NM_001788, NM_001363715
UniProt ID Q16181
Synonyms CDC3; CDC10; NBLA02942; SEPT7A
Summary This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19. provided by RefSeq, Jul 2011
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
GA100704 SEPTIN7 CRISPRa kit - CRISPR gene activation of human septin 7 1 kit
$1,657.00
KN205163BN SEPT7 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN205163LP SEPT7 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN205163RB SEPT7 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN405163 SEPT7 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products