OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

MAT1A Human Gene Knockout Kit (CRISPR)

Be the first to review this product
SKU
KN203765
MAT1A - human gene knockout kit via CRISPR, HDR mediated
  $1,657.00
4 Weeks*

Frequently Bought Together (4)

TA346036 Rabbit Polyclonal Anti-MAT1A Antibody
100 ul
$525.00
RC203765 MAT1A (Myc-DDK-tagged)-Human methionine adenosyltransferase I, alpha (MAT1A)
10 ug
$457.00
GE100003 pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
10 ug
$470.00
TT300007S A non-viral, non-electroporation, non-liposomal transfection kit using engineered mammalian proteins, tailored for high-efficiency delivery into a wide range of primary cells and difficult to transfect cell lines such as immune cells, stem cells, and neuronal cells.
20 ul
$265.00

Other products for "MAT1A or NM_000429"

Specifications
Specifications
Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Vector GFP-puro
Target Symbol MAT1A
Locus ID 4143
Components

KN203765G1, MAT1A gRNA vector 1 in pCas-Guide CRISPR vector

KN203765G2, MAT1A gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: AGACTCCTTCACTTAGAGAG

KN203765D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_000429
UniProt ID Q00266
Synonyms MAT; MATA1; SAMS; SAMS1
Summary This gene catalyzes a two-step reaction that involves the transfer of the adenosyl moiety of ATP to methionine to form S-adenosylmethionine and tripolyphosphate, which is subsequently cleaved to PPi and Pi. S-adenosylmethionine is the source of methyl groups for most biological methylations. The encoded protein is found as a homotetramer (MAT I) or a homodimer (MAT III) whereas a third form, MAT II (gamma), is encoded by the MAT2A gene. Mutations in this gene are associated with methionine adenosyltransferase deficiency. provided by RefSeq, Jul 2008
Shipping Ambient
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
GA102821 MAT1A CRISPRa kit - CRISPR gene activation of human methionine adenosyltransferase 1A 1 kit
$1,657.00
KN203765BN MAT1A - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN203765LP MAT1A - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN203765RB MAT1A - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN403765 MAT1A - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products