Junctional Adhesion Molecule 1 (F11R) Human Gene Knockout Kit (CRISPR)

CAT#: KN200004

F11R - human gene knockout kit via CRISPR, HDR mediated

Product Images

Specifications

Product Data

• Format: 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
• Donor DNA: GFP-puro
• Symbol: Junctional Adhesion Molecule 1
• Locus ID: 50848
• Components:

  KN200004G1, Junctional Adhesion Molecule 1 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: ACCGATTCCTCCCGAAACTC

  KN200004G2, Junctional Adhesion Molecule 1 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: GGACAAAGGCGCAAGTCGAG

  KN200004D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

  GE100003, scramble sequence in pCas-Guide vector

• Disclaimer: These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.

Reference Data

• RefSeq: NM_016946, NM_144501, NM_144502, NM_144503, NM_144504, NM_001348091
• UniProt ID: Q9Y624
• Synonyms: CD321; JAM; JAM1; JAMA; JCAM; KAT; PAM-1
• Summary: Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. The protein encoded by this immunoglobulin superfamily gene member is an important regulator of tight junction assembly in epithelia. In addition, the encoded protein can act as (1) a receptor for reovirus, (2) a ligand for the integrin LFA1, involved in leukocyte transmigration, and (3) a platelet receptor. Multiple 5' alternatively spliced variants, encoding the same protein, have been identified but their biological validity has not been established. [provided by RefSeq, Jul 2008]