OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Mouse Rbm20 activation kit by CRISPRa

Be the first to review this product
SKU
GA209588
Rbm20 CRISPRa kit - CRISPR gene activation of mouse RNA binding motif protein 20
  $1,657.00
4 Weeks*

Frequently Bought Together (1)

TA311192 Goat Anti-RBM20 (aa717-727) Antibody
100 ug
$565.00

Other products for "Rbm20"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol Rbm20
Locus ID 73713
Components

GA209588G1, Rbm20 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCCTAGTTGAATCTCTGAGC

GA209588G2, Rbm20 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATGGAGCATTGCTTGCTAAT

GA209588G3, Rbm20 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CGATACACCCCACTTGCCCA

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001170847
UniProt ID Q3UQS8
Synonyms 1110018J23Rik; 2010003H22Rik; AI646761
Summary RNA-binding protein that acts as a regulator of mRNA splicing of a subset of genes involved in cardiac development. Regulates splicing of TTN (Titin).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN514556 Rbm20 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products