OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Mouse Pnpla8 activation kit by CRISPRa

Be the first to review this product
SKU
GA207336
Pnpla8 CRISPRa kit - CRISPR gene activation of mouse patatin-like phospholipase domain containing 8
  $1,657.00
4 Weeks*

Other products for "Pnpla8"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol Pnpla8
Locus ID 67452
Components

GA207336G1, Pnpla8 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTTTGTTGGAGCTGAGTGCT

GA207336G2, Pnpla8 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTTGGGAGAGGCACCGCTT

GA207336G3, Pnpla8 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGCCCTATTACGTAGGCTT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_026164
UniProt ID Q8K1N1
Synonyms 1200006O19Rik; AI467579; Ipla2(gamma)
Summary Calcium-independent phospholipase A2, which catalyzes the hydrolysis of the sn-2 position of glycerophospholipids, PtdSer and to a lower extent PtdCho. Cleaves membrane phospholipids (By similarity).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN513552 Pnpla8 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products