OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Mouse St8sia4 activation kit by CRISPRa

Be the first to review this product
SKU
GA203901
St8sia4 CRISPRa kit - CRISPR gene activation of mouse ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
  $1,657.00
In Stock*

Other products for "St8sia4"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol St8sia4
Locus ID 20452
Components

GA203901G1, St8sia4 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGATTTCACTGTGCTTCGGT

GA203901G2, St8sia4 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATCCCACCAGAGGAACGCAA

GA203901G3, St8sia4 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCTAGGACGCCCAAACGTCA

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001159745, NM_009183
UniProt ID Q64692
Synonyms PST; PST-1; SIAT8-D; Siat8d; ST8SiaIV
Summary Catalyzes the polycondensation of alpha-2,8-linked sialic acid required for the synthesis of polysialic acid (PSA), which is present on the embryonic neural cell adhesion molecule (N-CAM), necessary for plasticity of neural cells.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN516816 St8sia4 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products