OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Mouse Ins1 activation kit by CRISPRa

Be the first to review this product
SKU
GA202174
Ins1 CRISPRa kit - CRISPR gene activation of mouse insulin I
  $1,657.00
4 Weeks*

Other products for "Ins1"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol Ins1
Locus ID 16333
Components

GA202174G1, Ins1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTGCTGGGAACTGGTTCATC

GA202174G2, Ins1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGTCTTAATAAGGGACCAGA

GA202174G3, Ins1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAACACATCTACTTAGTCTT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_008386
UniProt ID P01325
Synonyms Ins-1; Ins2-rs1
Summary This gene encodes insulin, a peptide hormone that plays a vital role in the regulation of carbohydrate and lipid metabolism. The encoded precursor protein undergoes proteolytic cleavage to produce a disulfide-linked heterodimeric functional protein that is stored in secretory granules. An increase in blood glucose levels, among others, induces the release of insulin from the secretory granules. Mice deficient in the functional hormone encoded by this gene develop diabetes mellitus. provided by RefSeq, Aug 2015
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN508354 Ins1 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products