OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Mouse Calb2 activation kit by CRISPRa

Be the first to review this product
SKU
GA200493
Calb2 CRISPRa kit - CRISPR gene activation of mouse calbindin 2
  $1,657.00
4 Weeks*

Other products for "Calb2"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol Calb2
Locus ID 12308
Components

GA200493G1, Calb2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCTGTCCTGTGACTCCCTCG

GA200493G2, Calb2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CATTTCCAGCTAAATACCTG

GA200493G3, Calb2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGACTTCTGGGTGCCCTCCG

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_007586, NM_001368293, NM_001368294
UniProt ID Q08331
Synonyms CR
Summary Calretinin is a calcium-binding protein which is abundant in auditory neurons.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN502451 Calb2 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products