OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human AK6 activation kit by CRISPRa

Be the first to review this product
SKU
GA119527
AK6 CRISPRa kit - CRISPR gene activation of human adenylate kinase 6
  $1,657.00
4 Weeks*

Frequently Bought Together (1)

TA336079 Rabbit Polyclonal Anti-TAF9 Antibody
100 ul
$585.00

Other products for "AK6"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol AK6
Locus ID 102157402
Components

GA119527G1, AK6 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTGAGTCCCTAATACATTGA

GA119527G2, AK6 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAACTTCACAATACCCAAAG

GA119527G3, AK6 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAACCCAATTGTGCAAGTGA

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001015891, NM_016283
UniProt ID Q9Y3D8
Synonyms AD-004; CGI-137; CINAP; CIP; hCINAP
Summary This gene encodes a protein that belongs to the adenylate kinase family of enzymes. The protein has a nuclear localization and contains Walker A (P-loop) and Walker B motifs and a metal-coordinating residue. The protein may be involved in regulation of Cajal body formation. In human, AK6 and TAF9 (GeneID: 6880) are two distinct genes that share 5' exons. Alternative splicing results in multiple transcript variants. provided by RefSeq, Sep 2013
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN400412 AK6 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products