OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human UNC80 activation kit by CRISPRa

Be the first to review this product
SKU
GA117196
UNC80 CRISPRa kit - CRISPR gene activation of human unc-80 homolog, NALCN channel complex subunit
  $1,657.00
4 Weeks*

Frequently Bought Together (1)

RC229478 UNC80 (Myc-DDK-tagged)-Human unc-80 homolog (C. elegans) (UNC80), transcript variant 2
10 ug
$3,930.00

Other products for "UNC80"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol UNC80
Locus ID 285175
Components

GA117196G1, UNC80 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAAAGCTCCTCCTACCCAGA

GA117196G2, UNC80 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCACCTCCCACTGTGGACAG

GA117196G3, UNC80 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTTTCAGCACCTCCCACTG

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_032504, NM_182587
UniProt ID Q8N2C7
Synonyms C2orf21; UNC-80
Summary The protein encoded by this gene is a component of a voltage-independent 'leak' ion-channel complex, in which it performs essential functions, such as serving as a bridge between two other components (sodium leak channel non-selective and UNC79) and as a scaffold for Src kinases. Leak channels play an importnat role in establishment and maintenance of resting membrane potentials in neurons. Mutations in this gene are associated with congenital infantile encephalopathy, intellectual disability and growth issues. provided by RefSeq, Aug 2016
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN412611 UNC80 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products