OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human PGP activation kit by CRISPRa

Be the first to review this product
SKU
GA117067
PGP CRISPRa kit - CRISPR gene activation of human phosphoglycolate phosphatase
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA343268 Rabbit Polyclonal Anti-PGP Antibody
100 ul
$585.00
RC214470 PGP (Myc-DDK-tagged)-Human phosphoglycolate phosphatase (PGP)
10 ug
$300.00

Other products for "PGP"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol PGP
Locus ID 283871
Components

GA117067G1, PGP gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAGCGCTTCACTCCGAATGC

GA117067G2, PGP gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGGCGAAGGTGCAGGCCAAT

GA117067G3, PGP gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTGGCTGGCAGGGCTCCAAC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001042371
UniProt ID A6NDG6
Synonyms AUM; G3PP; PGPase
Summary Glycerol-3-phosphate phosphatase hydrolyzing glycerol-3-phosphate into glycerol. Thereby, regulates the cellular levels of glycerol-3-phosphate a metabolic intermediate of glucose, lipid and energy metabolism. Was also shown to have a 2-phosphoglycolate phosphatase activity and a tyrosine-protein phosphatase activity. However, their physiological relevance is unclear (PubMed:26755581). In vitro, has also a phosphatase activity toward ADP, ATP, GDP and GTP (By similarity).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN414470 PGP - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products