OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human MUC16 activation kit by CRISPRa

Be the first to review this product
SKU
GA114314
MUC16 CRISPRa kit - CRISPR gene activation of human mucin 16, cell surface associated
  $1,657.00
4 Weeks*

Frequently Bought Together (1)

TA801872 MUC16 mouse monoclonal antibody,clone OTI3C6 100 ul
$447.00

Other products for "MUC16"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol MUC16
Locus ID 94025
Components

GA114314G1, MUC16 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TAGTCCAACATGAACCAGTC

GA114314G2, MUC16 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTGCCTTTGGGACTTCACGA

GA114314G3, MUC16 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTGTTCCCAAGGGATGACA

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_024690
UniProt ID Q8WXI7
Synonyms CA125
Summary This gene encodes a protein that is a member of the mucin family. Mucins are high molecular weight, O-glycosylated proteins that play an important role in forming a protective mucous barrier, and are found on the apical surfaces of the epithelia. The encoded protein is a membrane-tethered mucin that contains an extracellular domain at its amino terminus, a large tandem repeat domain, and a transmembrane domain with a short cytoplasmic domain. The amino terminus is highly glycosylated, while the repeat region contains 156 amino acid repeats unit that are rich in serines, threonines, and prolines. Interspersed within the repeats are Sea urchin sperm protein Enterokinase and Agrin (SEA) modules, leucine-rich repeats and ankyrin (ANK) repeats. These regions together form the ectodomain, and there is a potential cleavage site found near an SEA module close to the transmembrane domain. This protein is thought to play a role in forming a barrier, protecting epithelial cells from pathogens. Products of this gene have been used as a marker for different cancers, with higher expression levels associated with poorer outcomes. provided by RefSeq, May 2017
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products