OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human LUC7L activation kit by CRISPRa

Be the first to review this product
SKU
GA110887
LUC7L CRISPRa kit - CRISPR gene activation of human LUC7 like
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA344587 Rabbit Polyclonal Anti-LUC7L Antibody - middle region
100 ul
$585.00
RC221529 LUC7L (Myc-DDK-tagged)-Human LUC7-like (S. cerevisiae) (LUC7L), transcript variant 2
10 ug
$457.00

Other products for "LUC7L"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol LUC7L
Locus ID 55692
Components

GA110887G1, LUC7L gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCTCAAACGAGTCTCTACGG

GA110887G2, LUC7L gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTCGCAAGTTGTCCAACGG

GA110887G3, LUC7L gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGTGGTCGCAAGTTGTCCAA

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001320226, NM_001330420, NM_018032, NM_201412
UniProt ID Q9NQ29
Synonyms hLuc7B1; Luc7; LUC7B1; SR+89
Summary The LUC7L gene may represent a mammalian heterochromatic gene, encoding a putative RNA-binding protein similar to the yeast Luc7p subunit of the U1 snRNP splicing complex that is normally required for 5-prime splice site selection (Tufarelli et al., 2001 PubMed 11170747).supplied by OMIM, Mar 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN400146 LUC7L - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products