OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human HAO1 activation kit by CRISPRa

Be the first to review this product
SKU
GA110088
HAO1 CRISPRa kit - CRISPR gene activation of human hydroxyacid oxidase 1
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA501959 HAO1 mouse monoclonal antibody, clone OTI5A1 (formerly 5A1) 100 ul
$447.00
RC216834 HAO1 (Myc-DDK-tagged)-Human hydroxyacid oxidase (glycolate oxidase) 1 (HAO1)
10 ug
$457.00

Other products for "HAO1"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol HAO1
Locus ID 54363
Components

GA110088G1, HAO1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TACCTGTATGAAACCACTCT

GA110088G2, HAO1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGCCTTCCCAACCTCAACTT

GA110088G3, HAO1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATAGTGACTTCGGTGTTCTT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_017545
UniProt ID Q9UJM8
Synonyms GOX; GOX1; HAOX1
Summary This gene is one of three related genes that have 2-hydroxyacid oxidase activity yet differ in encoded protein amino acid sequence, tissue expression and substrate preference. Subcellular location of the encoded protein is the peroxisome. Specifically, this gene is expressed primarily in liver and pancreas and the encoded protein is most active on glycolate, a two-carbon substrate. The protein is also active on 2-hydroxy fatty acids. The transcript detected at high levels in pancreas may represent an alternatively spliced form or the use of a multiple near-consensus upstream polyadenylation site. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN416834 HAO1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products