OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human DNMT3L activation kit by CRISPRa

Be the first to review this product
SKU
GA109332
DNMT3L CRISPRa kit - CRISPR gene activation of human DNA methyltransferase 3 like
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA321824 Anti-DNMT3L Rabbit Polyclonal Antibody
100 ul
$305.00
RC200187 DNMT3L (Myc-DDK-tagged)-Human DNA (cytosine-5-)-methyltransferase 3-like (DNMT3L), transcript variant 1
10 ug
$457.00

Other products for "DNMT3L"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol DNMT3L
Locus ID 29947
Components

GA109332G1, DNMT3L gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCGCCCCTCCCACTGCAAAC

GA109332G2, DNMT3L gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGCCAGAGGTCACCAGGCTA

GA109332G3, DNMT3L gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGCTATGGGGGCAAAGAATC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_013369, NM_175867
UniProt ID Q9UJW3
Synonyms MGC1090
Summary CpG methylation is an epigenetic modification that is important for embryonic development, imprinting, and X-chromosome inactivation. Studies in mice have demonstrated that DNA methylation is required for mammalian development. This gene encodes a nuclear protein with similarity to DNA methyltransferases, but is not thought to function as a DNA methyltransferase as it does not contain the amino acid residues necessary for methyltransferase activity. However, it does stimulate de novo methylation by DNA cytosine methyltransferase 3 alpha and is thought to be required for the establishment of maternal genomic imprints. This protein also mediates transcriptional repression through interaction with histone deacetylase 1. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Jul 2012
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN400187 DNMT3L - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products