OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human MDN1 activation kit by CRISPRa

Be the first to review this product
SKU
GA108114
MDN1 CRISPRa kit - CRISPR gene activation of human midasin AAA ATPase 1
  $1,657.00
4 Weeks*

Other products for "MDN1"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol MDN1
Locus ID 23195
Components

GA108114G1, MDN1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGACTCGCGAACACAGCACG

GA108114G2, MDN1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AATCTAGTCGGTTTGGATGC

GA108114G3, MDN1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAGAAGAGTGCGTTAGGCCG

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_014611
UniProt ID Q9NU22
Synonyms Rea1
Summary Nuclear chaperone required for maturation and nuclear export of pre-60S ribosome subunits (PubMed:27814492). Functions at successive maturation steps to remove ribosomal factors at critical transition points, first driving the exit of early pre-60S particles from the nucleolus and then driving late pre-60S particles from the nucleus (By similarity). At an early stage in 60S maturation, mediates the dissociation of the PeBoW complex (PES1-BOP1-WDR12) from early pre-60S particles, rendering them competent for export from the nucleolus to the nucleoplasm (By similarity). Subsequently recruited to the nucleoplasmic particles through interaction with SUMO-conjugated PELP1 complex (PubMed:27814492). This binding is only possible if the 5S RNP at the central protuberance has undergone the rotation to complete its maturation (By similarity).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN417437 MDN1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products