OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human WWP1 activation kit by CRISPRa

Be the first to review this product
SKU
GA107598
WWP1 CRISPRa kit - CRISPR gene activation of human WW domain containing E3 ubiquitin protein ligase 1
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA365162 WWP1 rabbit polyclonal antibody
100 ul
$310.00
RC206243 WWP1 (Myc-DDK-tagged)-Human WW domain containing E3 ubiquitin protein ligase 1 (WWP1)
10 ug
$1,266.00

Other products for "WWP1"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol WWP1
Locus ID 11059
Components

GA107598G1, WWP1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAGTCTTCGGGTATGACCAA

GA107598G2, WWP1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GACCTTAAGAAGTCCTGCTC

GA107598G3, WWP1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGGACAGCCAATAGTAGGG

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_007013
UniProt ID Q9H0M0
Synonyms AIP5; hSDRP1; Tiul1
Summary WW domain-containing proteins are found in all eukaryotes and play an important role in the regulation of a wide variety of cellular functions such as protein degradation, transcription, and RNA splicing. This gene encodes a protein which contains 4 tandem WW domains and a HECT (homologous to the E6-associated protein carboxyl terminus) domain. The encoded protein belongs to a family of NEDD4-like proteins, which are E3 ubiquitin-ligase molecules and regulate key trafficking decisions, including targeting of proteins to proteosomes or lysosomes. Alternative splicing of this gene generates at least 6 transcript variants; however, the full length nature of these transcripts has not been defined. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN406243 WWP1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products