OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human IGF2BP1 activation kit by CRISPRa

Be the first to review this product
SKU
GA107292
IGF2BP1 CRISPRa kit - CRISPR gene activation of human insulin like growth factor 2 mRNA binding protein 1
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA815058 IGF2BP1 mouse monoclonal antibody,clone OTI1F7 100 ul
$447.00
RC216226 IGF2BP1 (Myc-DDK-tagged)-Human insulin-like growth factor 2 mRNA binding protein 1 (IGF2BP1), transcript variant 1
10 ug
$537.00

Other products for "IGF2BP1"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol IGF2BP1
Locus ID 10642
Components

GA107292G1, IGF2BP1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGTCCCCAGGTCAGACCCG

GA107292G2, IGF2BP1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGCACCACCCGGGACACTGC

GA107292G3, IGF2BP1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGACCATTCAAATCTCCACC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001160423, NM_006546
UniProt ID Q9NZI8
Synonyms CRD-BP; CRDBP; IMP-1; IMP1; VICKZ1; ZBP1
Summary This gene encodes a member of the insulin-like growth factor 2 mRNA-binding protein family. The protein encoded by this gene contains four K homology domains and two RNA recognition motifs. It functions by binding to the mRNAs of certain genes, including insulin-like growth factor 2, beta-actin and beta-transducin repeat-containing protein, and regulating their translation. Two transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, May 2009
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN216226 IGF2BP1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN216226BN IGF2BP1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN216226LP IGF2BP1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN216226RB IGF2BP1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN416226 IGF2BP1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products