OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human DRAK2 (STK17B) activation kit by CRISPRa

Be the first to review this product
SKU
GA106178
STK17B CRISPRa kit - CRISPR gene activation of human serine/threonine kinase 17b
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA349656 Rabbit Polyclonal Anti-STK17B Antibody
100 ul
$205.00
RC204169 STK17B (Myc-DDK-tagged)-Human serine/threonine kinase 17b (STK17B)
10 ug
$457.00

Other products for "STK17B"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol STK17B
Locus ID 9262
Components

GA106178G1, DRAK2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTTGTAGGAACAGAACCAA

GA106178G2, DRAK2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCCTAACAAGAATAAACCCT

GA106178G3, DRAK2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTGGTTAAGTGTGTGACATC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_004226
UniProt ID O94768
Synonyms DRAK2
Summary Phosphorylates myosin light chains (By similarity). Acts as a positive regulator of apoptosis.UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN404169 STK17B - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products