OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human SLC35A2 activation kit by CRISPRa

Be the first to review this product
SKU
GA105066
SLC35A2 CRISPRa kit - CRISPR gene activation of human solute carrier family 35 member A2
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA360247 SLC35A2 Antibody - C-terminal region
100 ul
$585.00
RC220288 SLC35A2 (Myc-DDK-tagged)-Human solute carrier family 35 (UDP-galactose transporter), member A2 (SLC35A2), transcript variant 1
10 ug
$686.00

Other products for "SLC35A2"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol SLC35A2
Locus ID 7355
Components

GA105066G1, SLC35A2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa

GA105066G2, SLC35A2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa

GA105066G3, SLC35A2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001032289, NM_001042498, NM_001282647, NM_001282648, NM_001282649, NM_001282650, NM_001282651, NM_005660
UniProt ID P78381
Synonyms CDG2M; CDGX; UDP-Gal-Tr; UGALT; UGAT; UGT; UGT1; UGT2; UGTL
Summary This gene encodes a member of the nucleotide-sugar transporter family. The encoded protein is a multi-pass membrane protein. It transports UDP-galactose from the cytosol into Golgi vesicles, where it serves as a glycosyl donor for the generation of glycans. Mutations in this gene cause congenital disorder of glycosylation type IIm (CDG2M). Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. provided by RefSeq, Oct 2014
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN407769 SLC35A2 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

Slc35a2 mosaic knockout impacts cortical development, dendritic arborisation, and neuronal firing
Spyrou, Aung, Vanyai et al
Neurobiology of Disease (2024)
Cited by 15
AI Summary: OriGene contributed to this study by providing the CRISPR knockout kit for Slc35a2, specifically the pCas-Guide-Slc35a2 plasmid, which was used to generate Slc35a2 mosaic knockout models for investigating cortical development and neuronal function.
Snippet: A CRISPR knockout kit for Slc35a2 was obtained from OriGene. The plasmid in this kit (pCas-Guide-Slc35a2) encodes humanised Cas9 and a mouse Slc35a2-specific single guide RNA (sgRNA). Sanger sequencing was performed at the Australian Genome Research Facility (AGRF, Melbourne, VIC, Australia) to verify the sgRNA sequence as GGTTGGTGGATCTACCGCTG
Showing 1-1 of 1 papers.
Powered by BizGenius
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products