OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human SRD5A1 activation kit by CRISPRa

Be the first to review this product
SKU
GA104614
SRD5A1 CRISPRa kit - CRISPR gene activation of human steroid 5 alpha-reductase 1
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA360575 SRD5A1 Antibody - middle region
100 ul
$585.00
RC202747 SRD5A1 (Myc-DDK-tagged)-Human steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1) (SRD5A1)
10 ug
$450.00

Other products for "SRD5A1"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol SRD5A1
Locus ID 6715
Components

GA104614G1, SRD5A1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCAGGCTTCTCCGGGGTAGC

GA104614G2, SRD5A1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTGAGCCCGCGTGGGAAACC

GA104614G3, SRD5A1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGTTACTGCGGCCCCGGCGT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001047, NM_001324322, NM_001324323, NR_136739
UniProt ID P18405
Synonyms S5AR 1
Summary Steroid 5-alpha-reductase (EC 1.3.99.5) catalyzes the conversion of testosterone into the more potent androgen, dihydrotestosterone (DHT). Also see SRD5A2 (MIM 607306).supplied by OMIM, Mar 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN402747 SRD5A1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products