OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human IL12B activation kit by CRISPRa

Be the first to review this product
SKU
GA102402
IL12B CRISPRa kit - CRISPR gene activation of human interleukin 12B
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA807426 IL12B mouse monoclonal antibody, clone OTI1A3 (formerly 1A3) 100 ul
$447.00
RC209679 IL12B (Myc-DDK-tagged)-Human interleukin 12B (natural killer cell stimulatory factor 2, cytotoxic lymphocyte maturation factor 2, p40) (IL12B)
10 ug
$300.00

Other products for "IL12B"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol IL12B
Locus ID 3593
Components

GA102402G1, IL12B gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTCCTTCTTCCTCGATCTG

GA102402G2, IL12B gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GTGGGGAATAAGGAAGGAGA

GA102402G3, IL12B gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGTGCTTGGAGACAGCACT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_002187
UniProt ID P29460
Synonyms CLMF; CLMF2; IL-12B; IMD28; IMD29; NKSF; NKSF2
Summary This gene encodes a subunit of interleukin 12, a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. Interleukin 12 is a disulfide-linked heterodimer composed of the 40 kD cytokine receptor like subunit encoded by this gene, and a 35 kD subunit encoded by IL12A. This cytokine is expressed by activated macrophages that serve as an essential inducer of Th1 cells development. This cytokine has been found to be important for sustaining a sufficient number of memory/effector Th1 cells to mediate long-term protection to an intracellular pathogen. Overexpression of this gene was observed in the central nervous system of patients with multiple sclerosis (MS), suggesting a role of this cytokine in the pathogenesis of the disease. The promoter polymorphism of this gene has been reported to be associated with the severity of atopic and non-atopic asthma in children. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN409679 IL12B - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products