OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human IL2 activation kit by CRISPRa

Be the first to review this product
SKU
GA102376
IL2 CRISPRa kit - CRISPR gene activation of human interleukin 2
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA810724 IL2 mouse monoclonal antibody,clone OTI2C9 100 ul
$447.00
RC210013 IL2 (Myc-DDK-tagged)-Human interleukin 2 (IL2)
10 ug
$150.00

Other products for "IL2"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol IL2
Locus ID 3558
Components

GA102376G1, IL2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TATGCAATTAGCTCATTGTG

GA102376G2, IL2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TTTTCCTCCTTTCTTTAAGG

GA102376G3, IL2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AACATGTGAATAGCATATTG

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_000586
UniProt ID P60568
Synonyms IL-2; lymphokine; TCGF
Summary This gene is a member of the interleukin 2 (IL2) cytokine subfamily which includes IL4, IL7, IL9, IL15, IL21, erythropoietin, and thrombopoietin. The protein encoded by this gene is a secreted cytokine produced by activated CD4+ and CD8+ T lymphocytes, that is important for the proliferation of T and B lymphocytes. The receptor of this cytokine (IL2R) is a heterotrimeric protein complex whose gamma chain is also shared by IL4 and IL7. The expression of this gene in mature thymocytes is monoallelic, which represents an unusual regulatory mode for controlling the precise expression of a single gene. The targeted disruption of a similar gene in mice leads to ulcerative colitis-like disease, which suggests an essential role of this gene in the immune response to antigenic stimuli. provided by RefSeq, Sep 2020
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN410013 IL2 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products