OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human HSF1 activation kit by CRISPRa

Be the first to review this product
SKU
GA102251
HSF1 CRISPRa kit - CRISPR gene activation of human heat shock transcription factor 1
  $1,657.00
4 Weeks*

Frequently Bought Together (1)

RC200314 HSF1 (Myc-DDK-tagged)-Human heat shock transcription factor 1 (HSF1)
10 ug
$738.00

Other products for "HSF1"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol HSF1
Locus ID 3297
Components

GA102251G1, HSF1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GGGGTGGGACCAACACGCGC

GA102251G2, HSF1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACTGGAGCCTGAGCCCGAGC

GA102251G3, HSF1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGCCCAAGACCGATTCACT

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_005526
UniProt ID Q00613
Synonyms HSTF1
Summary The product of this gene is a transcription factor that is rapidly induced after temperature stress and binds heat shock promoter elements (HSE). This protein plays a role in the regulation of lifespan. Expression of this gene is repressed by phosphorylation, which promotes binding by heat shock protein 90. provided by RefSeq, Jul 2017
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN200314 HSF1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN200314BN HSF1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN200314LP HSF1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN200314RB HSF1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN400314 HSF1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products