OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human EGR1 activation kit by CRISPRa

Be the first to review this product
SKU
GA101356
EGR1 CRISPRa kit - CRISPR gene activation of human early growth response 1
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA330209 Rabbit Polyclonal Anti-EGR1 Antibody
100 ul
$585.00
RC209956 EGR1 (Myc-DDK-tagged)-Human early growth response 1 (EGR1)
10 ug
$758.00

Other products for "EGR1"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol EGR1
Locus ID 1958
Components

GA101356G1, EGR1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGAAGGGTCTGGAACGGCAC

GA101356G2, EGR1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCTAATATGGCAGGACCGGC

GA101356G3, EGR1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGGGGGGCTTCACGTCACTC

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001964
UniProt ID P18146
Synonyms AT225; G0S30; KROX-24; NGFI-A; TIS8; ZIF-268; ZNF225
Summary The protein encoded by this gene belongs to the EGR family of C2H2-type zinc-finger proteins. It is a nuclear protein and functions as a transcriptional regulator. The products of target genes it activates are required for differentitation and mitogenesis. Studies suggest this is a cancer suppressor gene. provided by RefSeq, Dec 2014
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN209956 EGR1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN209956BN EGR1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN209956LP EGR1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN209956RB EGR1 - human gene knockout kit via CRISPR, HDR mediated 1 kit
$1,657.00
KN409956 EGR1 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products