OriGene Logo

Customer Login

Checkout as a new customer

Creating an account has many benefits:

  • See order and shipping status
  • Track order history
  • Check out faster
Create an Account

Human B7-2 (CD86) activation kit by CRISPRa

Be the first to review this product
SKU
GA100664
CD86 CRISPRa kit - CRISPR gene activation of human CD86 molecule
  $1,657.00
4 Weeks*

Frequently Bought Together (2)

TA813079 CD86 mouse monoclonal antibody,clone OTI11C8 100 ul
$447.00
RC217341 CD86 (Myc-DDK-tagged)-Human CD86 molecule (CD86), transcript variant 1
10 ug
$450.00

Other products for "CD86"

Specifications
Specifications
Product Data
Format 3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Target Symbol CD86
Locus ID 942
Components

GA100664G1, B7-2 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AACTCTCCACACTTTGGTTG

GA100664G2, B7-2 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CAGTTTAAACTCATTGACGT

GA100664G3, B7-2 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACAGATTTTGACCACACTTG

1 CRISPRa-Enhancer vector, SKU GE100056

1 CRISPRa scramble vector, SKU GE100077
OTI Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Shipping Ambient
Reference Data
RefSeq NM_001206924, NM_001206925, NM_006889, NM_175862, NM_176892
UniProt ID P42081
Synonyms B7-2; B7.2; B70; CD28LG2; LAB72
Summary This gene encodes a type I membrane protein that is a member of the immunoglobulin superfamily. This protein is expressed by antigen-presenting cells, and it is the ligand for two proteins at the cell surface of T cells, CD28 antigen and cytotoxic T-lymphocyte-associated protein 4. Binding of this protein with CD28 antigen is a costimulatory signal for activation of the T-cell. Binding of this protein with cytotoxic T-lymphocyte-associated protein 4 negatively regulates T-cell activation and diminishes the immune response. Alternative splicing results in several transcript variants encoding different isoforms.provided by RefSeq, May 2011
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Review image
Documents
Resources
Other Versions
SKU Description Size Price
KN406513 CD86 - KN2.0, Human gene knockout kit via CRISPR, non-homology mediated. 1 kit
$1,657.00

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Related Products